SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0010
JBrowseBomo_Chr5
chromosome_No.
Scaffold_id
Scaffold Length
chromo5
Bm_scaf9
8107424 bp
UniRef
UniRef50_Q9QXL8 (37%/79)
Cluster: Nucleoside diphosphate kinase 7; n=27; Eumetazoa|Rep: Nucleoside diphosphate kinase 7 - Mus musculus (Mouse)
Ontology
GO:0000166 F nucleotide binding
GO:0000287 F magnesium ion binding
GO:0004550 F nucleoside diphosphate kinase activity
GO:0005524 F ATP binding
GO:0006183 P GTP biosynthetic process
Orthologue
Sequence
(Nucleotide)
ATTCGGTCAACACTAAGACGTATCACATAATAATGACATATATACATTATTCATAACAGA
GAATTCGTTTCTTTGATGAGAAGATTGTGTGCTAATAAAACAGACTACAAAAATAAACGC
ATATTTTTTTACGAAATTTTACAAGTATTTTAATAATAATAATTATACTTGCTATCCTAT
TGACTTCAACATTGCATACTTTTATTACCTAACATAAACAGGTTGATATCGATAGCAATG
GTATACGACTACTTGATAAATATAGTTTCNTGTGTGAAATGTATGATGAGGATGCTGACG
AAATAAAAGATTTAACCCTCAATTATTTTCCATTTGACAATTCGGTTCAAATAATAGACG
CGAAGAAAGGCAAAAATGTTTTGAAACGAGTACAACTACCACCATTAAATTTAGATATGT
TACAAATCGGTAATATAGTTAATATATTTTCNAAATTATTATATATCCAGGATTGCGGCT
CCTGCTACACGGAAAACGCTTTCCAAAAGTGCCAAGTACTTTGCCATGATTTNAGCCGAT
AGCTCCCAGTGGACCTGGGAAAATAATCCCCTTTCATCATGGAAAATGGATTTCGCAT
(598 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).