SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0008
JBrowseBomo_Chr2
chromosome_No.
Scaffold_id
Scaffold Length
chromo2
Bm_scaf118
704489 bp
UniRef
UniRef50_Q1D2F5 (38%/60)
Cluster: Putative lipoprotein; n=1; Myxococcus xanthus DK 1622|Rep: Putative lipoprotein - Myxococcus xanthus (strain DK 1622)
Ontology
GO:0004222 F metalloendopeptidase activity
GO:0005578 C proteinaceous extracellular matrix
GO:0006508 P proteolysis
GO:0005643 C nuclear pore
GO:0006810 P transport
Orthologue
Sequence
(Nucleotide)
AGAAACAAGGCGTTTTAACATTTAGTTACTATGGCTGGCGTCCTGAGAATACAACACGGG
AAGCAGTTGGGAGCGTTGTTTATGTTATGTTGTCTAGTTTTACCAGCTCTATCCGCAGAA
GACGTTAGCTATCAAGCCTGCGTCGATAAATACTCCAGGAAAGGTTACCAGCCGTGGCAA
GAGTGGTCGGATCACTACACGTGCCACCGCTACAGATGCGAGATCAGAGACGGGAAATAC
TTCATAGCTGCTGTGGATGTCGAAAACCAAAAATACCGGAAAACGCACTGGAATGCCACG
AATACATCGAAGATGAGAATGTCGAATTCCCCACGTGCTGTGCGCGATTGCGTTGCGTCG
TCGAAGTAAATGGAGAGAGAATAGTGCAAACCAGAGGGCAGCCTGGCGAACTGTTCCCCG
ATAAACCATGGAAGGGCCAACAAAACGAGCCAAATCCTGCTGTTGTCGGAATGAGCGGCA
TCCAGCAGACACCGGTCGGTGGCGAGCCCAGGGTCAGGCGTCTCCTGGAATATTTAACAG
CAGAGGAGCAGCGGATGGCAGCGATATTAGCAGCCGTCGGTTTATCGACTACCCCGCGCC
GCAGATGCAGGACAGCCCCCGANGAAAGCGCTCCACAGTGTACCCGCTGTTTGACAGAAC
GAATCGGGGAACACAACTTATCAAAAGTCACCCCGTCA
(698 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).