SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0002
JBrowseBomo_Scaf185
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf18
5904300 bp
UniRef
UniRef50_Q86PF4 (55%/117)
Cluster: CG10126-PB, isoform B; n=7; Endopterygota|Rep: CG10126-PB, isoform B - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005509 F calcium ion binding
GO:0016301 F kinase activity
GO:0005737 C cytoplasm
GO:0007242 P intracellular signaling cascade
Orthologue
Sequence
(Nucleotide)
AAAACAAAGAGTTGAAAATTTAAATTTCATTTGAATTTTTAAAAGACATCCAAAATTGAT
TTTAGCCGAGGCAGAATGAGCAGCGCCTCGATGGCGGCTTGCTTCAACTACGAGAATTCG
CCAAAAGTAAAAGCTGAAATGGAGAGCTCAGTTGCGTGGCACAGACCGATGTCTGCTGGT
TCCGTCCAGGAGGAAGAGCTGATGCAAAAGAGTGCTCGTGCTATGACACAAGCTACTGAT
CCTCTGGAGAAACTCGCTTGCTTTGCTTGTCCCGAGGTGCTTCAGGGATCTTGGGACTTG
GAAGAATTTTCCGTCGCATGGATGATGATGGAAGTAAACTACTGAACAAAGAAGAATTCC
TTTATGGCATCAAGGAAACAGGGCTGGAACTTAATAAAAGTGAAGCCGAAGAACTCTTCA
GTCAATTCGACACAGACAGTAGTGGCTCAATCAGTCTTGATGAATTCCTTATTAAAATCC
GTCCTCCCATGTCGGAATCGCGTCGTAAATTGTAGAACAAGCATTCAAGAAGCTTGACAA
GACTGGTGACGGTGCAATCACAATTGATGACATTAAAGGGTGTTTACTCTGTCGATTC
(598 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).