SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamefbVf0103
JBrowseBomo_Scaf045
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf8433_contig53643
802 bp
UniRef
UniRef50_A0ST23 (100%/35)
Cluster: Putative reverse transcriptase; n=4; Magnoliophyta|Rep: Putative reverse transcriptase - Zingiber officinale (Ginger)
Ontology
GO:0003964 F RNA-directed DNA polymerase activity
GO:0016491 F oxidoreductase activity
GO:0050381 F unspecific monooxygenase activity
Orthologue
Sequence
(Nucleotide)
GCTCTGAGGACCGGGGCGTGTCGGGTTTGGACGGGAAGCGGATGCGGCCGGTGCCGGGTC
TGGTCGATGTTCGTGCGTTATGTTCGTTTTAGCGAGTTAGTATTTTAATATAATGCGGCC
TCAAAAACTGTATATATTTAATATGACACTCGCGAAAATCGTCTTACGTTTCGGACTGGA
TCCGGACCCGCGTTCTCCGGCCTTCCGCGGATCTTCCTAGCCGTAAGGTCGTGTCGGTTT
CGTTTCGTGCGCGACGGCACGATTCTGTACGACCGCCGTTCAACGGTCAGCTCAGAACTG
GCACGGACAAGGGGAATCCGACTGTCTAATTAAAACAAAGCATTGCGATGGCCCTCGCGG
GTGTTGACGCAATGTGATTTCTGCCCAGTGCTCTGAATGTCAACGTGAAGAAATTCAAGC
AAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAGGGTACCGAGCTCGAATTCGT
AATCATGGTCATAGCTGTNNNNNNNNNNNATTGTTATCCGCTCACAATTCCACACAACAT
ACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATT
AATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTA
ATGAATCGGCCAACGCGCGGGGAGA
(685 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).