SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamefbVf0079
JBrowseBomo_Scaf063
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf791
9086 bp
UniRef
UniRef50_Q9AVH2 (89%/46)
Cluster: Putative senescence-associated protein; n=4; Eukaryota|Rep: Putative senescence-associated protein - Pisum sativum (Garden pea)
Ontology
Orthologue
Sequence
(Nucleotide)
CTACAGACTATTCCGAGCCCCGACATCGAACTGAGTTATATCCGGACCTTCGGAGCCGTG
ATGCACGTGTTAAGAAAAAAACCGATAGCATCGATCTCCGCGATCCAAATGGGCTTCGAC
GTCGCGTCTCGCGTTTTGAATGCGAAACGCGACTAGTAAAGTCACATTGTTTAGAGCCTC
CCGACTCTCGGGGCTCCACAGTGAGCATATCCTTGCCGGATTCGGCTAGGCTGGCTTCGG
CCTTAGAGGCGTTCGGCATAATCCCGCGGATGGTAGCTTCGCACCACCGGCCGCTCGGCC
GAGTGCATGAACCAAATGTCCGAAACTGCGGTTCCTCTCGTACTGAGCAGTATTACTATC
GCAACGACAAGCCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAATCCCAGCT
CACGTTCCCTTTTGATGGGTGAACAATCCAACGCTTGGCGAATTTTGCTTCGCAATGATA
GGAAGAGCCGACATCGAAGGATCAAAAACAACGTCGCTATGAACGCTTGGCTGCCACAAG
CCAGTTATCCCTGTGGTAACTTTTCTGGCACTCTTGCTAAAAACTCTTTATACTAATGGA
TCGATAAGCCGTGCTTT
(617 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).