SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamefbVf0055
JBrowseBomo_Chr14
chromosome_No.
Scaffold_id
Scaffold Length
chromo14
Bm_scaf38
4008358 bp
UniRef
UniRef50_A0YR65 (34%/46)
Cluster: Glycerophosphoryl diester phosphodiesterase; n=1; Lyngbya sp. PCC 8106|Rep: Glycerophosphoryl diester phosphodiesterase - Lyngbya sp. PCC 8106
Ontology
GO:0005509 F calcium ion binding
GO:0006071 P glycerol metabolic process
GO:0008889 F glycerophosphodiester phosphodiesterase activity
Orthologue
Sequence
(Nucleotide)
CTAGTATTAGCAGCAGAAGTGTAGTCCTTAAAATTGTTCGCCGAAAACAATTTTCAAATA
CAATAGGAAAGCCAAAGAGCCAATTGTAAGAAGTGACGCATTGGAAGTTGACTATGGAAC
TCTAACGTTTACCGCTGTATTTCCGAGCATTAGCGACCTACAGTTGAGCAATGCTGAAGT
TTTTAGTTACGTCCATGAAATCAATCCAAAATTCATTTTAGGACCTCTTCTATCGTTTAG
TCTAGATTCTGAGAACAAAGTCAGTTAGGCAAGCTGCTGAACAACATCGCGGTTAGTCTT
CAAGAAGTATTTGAAGCGCAAGGAACTATTTTAATGACCAGTTATATACAGTACGATATC
TGTGACTTTGGATTAGAGTTAGCGTCTTAAAGAAAATGAATTAAAATTTTATGTAATTTA
TGTGTCATTTCATCTATGTTTTATTTTAATAAAAATTAACGTTTC
(465 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).