SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0039
JBrowseBomo_Chr12
chromosome_No.
Scaffold_id
Scaffold Length
chromo20
Bm_scaf37
4206046 bp
UniRef
UniRef50_P41658 (96%/59)
Cluster: Late expression factor 5; n=13; Nucleopolyhedrovirus|Rep: Late expression factor 5 - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
GO:0006350 P transcription
GO:0006355 P regulation of transcription, DNA-dependent
GO:0030528 F transcription regulator activity
GO:0045449 P regulation of transcription
GO:0003676 F nucleic acid binding
Orthologue
Sequence
(Nucleotide)
TTTTTTTTTTGAATGATAAAGTTATTTATTTACAAAACAGTAATAAAAATAAACTATTTG
AGCTTAGCGGGCTTAGTTTAAAATCTTGCAGACACGATTTTGTAACAGTCGAAAGCCAAA
CGAGGGCAGGCGACGAAATCGCTTCGTTCCTTCGCTACTGTCGGATGTGTGGAATGTCTG
GCTGTTAATAGTAGCGTGTTCTGTAACTTCGGCGGCTTGTCAATGAACGGCTCCTGGATC
TTCTGTATGTGCGAGGTCTACCCGGGCGGCGTCTGTAACCCGAGCTTCTGCGTCTGCGTG
TGATACCGGTTGAAGAACGGCGCCGGCGTGTCAAACCATATGTGGCACCGGTTGAAGAAC
GACGACGGGATCCGCCGCCGCCGAATTCGGCGGCCGCGGATCCTTTTTTTTTTGACGACT
CTATATTTTGTAAAGCTTTTTGACGGCTGTAATATAACCGGTGATTAAGTGCTCTTATAT
AGTCGCTGTATGTATTAAGGTCGAGAGAGTCTATACTTTTAGGGATGTAGGGTTTAAACC
CGAATAACAGTTCTAATGGTGAAAAGCCTGTGGTAGAGTGGATATTGGAATTGTACGCTA
GCATTGCTGTTCTAAGATATAAGTCCCATGTATGTTGGTTTTCAACTATATACGACCTAA
GATATTCTTTCAGAGTCGAATGACTTCTTTCTAGGGCGCCACAAGTCTGCGGGTGATATG
GAGAAGCAAAAATGTGTTTTATTCCGAATAAACGCTCTAACTGCTTCATTACTTCGGAAG
AGAAGTTAGCACCTTGATCTGTAATAATGATCTTAGGGATACCGAT
(826 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).