SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0037
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf108
1018582 bp
UniRef
UniRef50_UPI00015B4C08 (56%/46)
Cluster: PREDICTED: similar to CG2534-PB; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to CG2534-PB - Nasonia vitripennis
Ontology
GO:0005515 F protein binding
GO:0005912 C adherens junction
GO:0005915 C zonula adherens
GO:0005938 C cell cortex
GO:0007163 P establishment and/or maintenance of cell polarity
Orthologue
Sequence
(Nucleotide)
CGCTGCCCCACCCTTCAAACTGAAACGCATTGCTGCTTCACGGCAGAAATAGTTATAATG
ATTCTATACATGTCGGATTTTGCAGATACGAGTCGAGGAGGGCGGTTGGCTGGGGGCCGG
ACTGCTGATCCCCGGGGACGGGTTCAGCGCGGAGGTGGTCCGCGGCAGTGCCCCCCGGGC
TGGCGGAGTTCGTGGCCCCCCTGCAGCGGGCGGGGCTGTGTCTGCTCGCACACCAGCCGC
ACGCGGTCGGCGCGTGGACCGTGTACATGGGCCGAGCGTCCCCGCTTACCGCCGCCCGTC
CCCGACCGACATATCCTGCAACTACATAAGAATGCTAACGGCATGGGACTCATTTTAGTC
TCCGCAAAGGTACTTTTTTCGCATTTTCAACTCAAAACATTAAAACCATAATATGCAGTC
TAATATAAATAACAATACCAATAACAAGTTTGATAAAACTTTGTGGCTCTAATGGTAGTC
CTTATGGACGAGAGAAAAAAAACCACACATCTCATAAAAACGGTTTAAATGATGTTTACC
TTCCGGTCTCAAAGATGGGTTAGCCAAATTATTGTATATTCAGATTGTCTCAGGTTTGTC
TTGTTTGATGTCTTTGCTATTCTCTACGAGGAAACTCTGCTTATATCGCTATGTATACCG
GTATGTATGTATGTCTCTCGTATGTATATCGGCATGTATGTATGTCTCTCGTATGTATAT
CGGTATGTATGTATGTCTCT
(740 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).