SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0036
JBrowseBomo_Scaf010
chromosome_No.
Scaffold_id
Scaffold Length
chromo27
Bm_scaf48
2966211 bp
UniRef
UniRef50_Q86QT5 (50%/58)
Cluster: Putative uncharacterized protein; n=1; Bombyx mori|Rep: Putative uncharacterized protein - Bombyx mori (Silk moth)
Ontology
GO:0000155 F two-component sensor activity
GO:0000156 F two-component response regulator activity
GO:0000160 P two-component signal transduction system (phosphorelay)
GO:0004673 F protein histidine kinase activity
GO:0004871 F signal transducer activity
Orthologue
Sequence
(Nucleotide)
CAGAAACACCGACTATCACGAGAAGACGCCTGTTTCGTCAACGATTTGGATATTAATATA
TTTATACTAGCTGACCCGTCAGACTTCGTAGTGCCTCGATCGATAAATAAAAGACCTAAA
CTTTGGTATAAAATAAACTTAAAAAAATACAAAAGGAATCCGTCCGACGGGGGGGACATC
AAAGGAAAAACAAAATTGTTTGTTTTTATATAATTCCGAGCATTTTCATATTTTTTCAAA
CTTTTAAACCTTCTCTGGACTTCTACGAATAATTCAAGACCAAAATTAGCCAAATCGGTC
CAGCCGTTTTCGAGTTTTAGCGAGACTAACGAACAGCAATTCATTTTTATATATATAGAT
AGAAGATAGATTTCGTTACTATGCGTTATTCATCTCTTTGATGTAGTTGTGTTGAGTAAA
TTCTTATCACACACGAAGCAGACAGAGATCCATTTGGTTAACTAGCGACGACGCCTTTTA
GGTTATATTTGAGGCACGTGTCTGGAGTCCTGGCACGGCAACAGCCCCAACTACTATCGA
TCAGATCTCGAACAAAGCGTTCGCCTGTGCGTACTCCGTCACGAAGCCGACTCATTGGGA
ATTACGCACTTTATAATTTGTCGCAACCGTGTTATCTACGATGACGTATTATCATTGGCC
GATGGAGTGAAATAAAAAGGAATGACTACATAATTAAAATTAGATAGAAGATGTTTTTTT
CAATTTTGACAATAATGGTACCGATATTTTATGTTTATGTAATGTATGTTGGGTTTTTAA
TCATTGCATATTTCTCACAAAAGATACTCACTATATAAATGTTATTAAAC
(830 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).