SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0033
JBrowseBomo_Chr3
chromosome_No.
Scaffold_id
Scaffold Length
chromo3
Bm_scaf102
1187377 bp
UniRef
UniRef50_P04179 (68%/196)
Cluster: Superoxide dismutase [Mn], mitochondrial precursor; n=175; root|Rep: Superoxide dismutase [Mn], mitochondrial precursor - Homo sapiens (Human)
Ontology
GO:0000303 P response to superoxide
GO:0001315 P age-dependent response to reactive oxygen species
GO:0004784 F superoxide dismutase activity
GO:0005739 C mitochondrion
GO:0005743 C mitochondrial inner membrane
Orthologue
Sequence
(Nucleotide)
CATAATTTCATCATTTTTAATTCCGTGAAGTACATTTAGTAAATTCTAAAGTTGATCGGT
TTCCTTTTTATTGAACTTCTTTAGTCATCATGTTAATGTCACAAAGGATTGGATCATTGA
TTCGAGTTGCCGGTGCTTCTCGCCAGAAGCATACTTTGCCAGAGCTTCCGTACGAGTACA
ATGCACTGGAGCCGGTCATTAGCCGTGAAATCATGAGTCTTCATCACAGCAAACATCACG
CGACTTATATCAACAATCTAAACGTTGCTGAAGAGAAACTCGCACAGGCACAAGCTAAAG
GTGATATCGACACCATTATCAACCTTGCACCAGCCTTGAAATTCAATGGTGGTGGTCACA
TCAACCACTCGATCTTTTGGCACAACCTGTCACCAAATGGTGGCAAGCCTTCTGATGTTC
TCACCAAAGCCGTTGAGAAAGACTTTGGATCCTGGGATAACATAAAGAATCAACTGTCGA
CAGCTTCTGTGGCAGTACAGGGCTCAGGCTGGGGTTGGCTTGGCTACAACAAACAAATGA
AGAAATTGCAAATAGCTACATGCCAGAACCAGGATCCTCTGCAGGCCACCACTGGATTGG
TCCCGCTCTTCGGAATCGATGTATGGGAGCACGCGTACTATCTTCAGTACAAGAACGTTC
GTGCCGACTACGTGAAAGCTATTTTCGATGTAGCCAACTGGAATGATATATCTCAGAGAT
ATGAAAAAGCGCTCAAGTGAATAATTTCAAAAAAATCGGTTAAACCAATTTAGTTATTTA
TAAACGCTTTAAGACAACACATGGTGAATCTTTGTTAGAACAAGAGAATTAGTTATGTGA
TGCGAAATTAAATTTATTAAAATTCCCTTATTTAAAAAGATCCGCCG
(887 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).