SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0031
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf16
6248677 bp
UniRef
UniRef50_O95166 (90%/116)
Cluster: Gamma-aminobutyric acid receptor-associated protein (GABA(A) receptor- associated protein); n=18; root|Rep: Gamma-aminobutyric acid receptor-associated protein (GABA(A) receptor- associated protein) - Homo sapiens (Human)
Ontology
GO:0000226 P microtubule cytoskeleton organization and biogenesis
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0005764 C lysosome
GO:0005790 C smooth endoplasmic reticulum
Orthologue
Sequence
(Nucleotide)
CGATTCGATCATCTGAAATTGCAGTGTGTTATAAAATATCAACATGAAATTCCAATACAA
AGAAGAACATTCATTTGAGAAGAGAAAGGCTGAGGGCGAAAAAATCCGCAGGAAATATCC
AGATCGCGTTCCTGTAATTGTAGAGAAAGCGCCGAAGGCTAGGCTTGGAGACCTCGACAA
AAAGAAGTATTTAGTTCCGTCTGATTTAACAGTTGGCCAGTTCTACTTCTTGATCCGGAA
ACGTATTCACCTGCGGCCTGAAGACGCACTTTTCTTCTTCGTGAACAATGTCATTCCACC
CACATCTGCAACAATGGGGTCTCTCTATCAAGAACACCATGATGAAGATTTCTTTTTATA
CATAGCATTTTCCGACGAAAATGTCTATGGAAATTAATTCCAAATTATTCACTTTCAAAT
AGTTTTACACTATCTGACCATATGGTGAAATTTAATTTAAGTCTTAGATTAAAATTGTGT
ATTATTTTATGGTATTTTTTTTATTATTAATTGGCATATAATACTATTTTTGTCTTCATA
TGAATAGCATAAAACTTTTCAAGCAAGTAAGGGATTGCTTTGTTTTCACATCTTTGTTTT
GGTTGAGTGTCATCACTGCTGTAATAAAAAAAAAAAAAAAAAAA
(644 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).