SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0028
JBrowseBomo_Chr25
chromosome_No.
Scaffold_id
Scaffold Length
chromo25
Bm_scaf32
4385969 bp
UniRef
UniRef50_UPI0000D569F2 (39%/290)
Cluster: PREDICTED: similar to CG5521-PA; n=1; Tribolium castaneum|Rep: PREDICTED: similar to CG5521-PA - Tribolium castaneum
Ontology
GO:0005096 F GTPase activator activity
GO:0005622 C intracellular
GO:0051056 P regulation of small GTPase mediated signal transduction
Orthologue
Sequence
(Nucleotide)
CACGGACCGCGTGTCCCAGGCTACCCTCCTACGTCACGTGTTTGCTGCAGATGCTCATGA
TGAAAAACAAAAACATTGCCAAAGTCGTCAGCGATTGCATATTAGTGCTTGCCGATTACA
CTGACCGTATTGTAGAGATGTACCCAGGACTAGCTGGAAAAATAATTAGATGGATCTGCG
CATGCTTGGCCCAACTTTCGACCAGCTGCCACCGTGACACCGTCAAACCACTGGCCGGGT
CACTGCTGCTGTGCTTGGCCGAGTTTGCGGTACGTTGCGGACCTCAGTACTTAATGGAAG
AGAAGGATGGAGAACAAACACTTTTGCTGTTGATTTTTAAGGTGTTGTACGCGGTTATGA
AAGGAGCAAACGGATCCGACATTGAAGGCCTAAGTCTGCCGGTGGATGACGACTTCGACC
CAACTATACAGCTGGATAATCTCGGGCCTAAAACGATTCCGGCATCAACGATCGACGTCA
AGCTTTGGGCTCAAACGATATGCACTCAGCTGGTACTGTACCTCGGGCACTGGCCTCTAT
GGAGCGGATGCCAACTGTCCTGTCGTGTTTCCGAGCAACACGACAGTCCGTCCCTGGGCG
AGGAGCTGGGCCCCGCCGTGCTGACCGCGCCCAACATACAGCTGATGCGGTTCAGCGATT
CGACTCTGGCCTCGCTCATTGAGCTGCCGGCCCTCGACCTGCCCGCCAGAGCCGGGACTA
CACCAGGTCTGACGACGTCGGAGCGTCAGGTGCGCGTGCTGCTGCGCGACATCGGCGGCA
AGGCCTGCTGGGACGCGTCCGCGCTGTACTTCGACCCGTCGGGGGGGCAGCTCGAGGGGG
GGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTA
CAACGTCGTGACCTGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACA
(956 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).