SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0026
JBrowseBomo_Chr5
chromosome_No.
Scaffold_id
Scaffold Length
chromo5
Bm_scaf54
2693215 bp
UniRef
UniRef50_P48610 (82%/188)
Cluster: Arginine kinase; n=363; Eukaryota|Rep: Arginine kinase - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003824 F catalytic activity
GO:0004054 F arginine kinase activity
GO:0005575 C cellular_component
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
Orthologue
Sequence
(Nucleotide)
GCGGACCGTTTTTTTTTTTTTTTTTTAGTCTTAACGCTAGATGTCTTTATTTTCCATTTC
CTTATAGAAAATACGTTTTACAATAAAGAGTAGTAGTGGAGGAGGGGCGGCCCGCTGACT
AGTGCCCGGCCTCCGCGGAACGATAAATAAATACACAGTCGGCTCGCGGCGGCGCCTACA
GAGACTTCTCGATCTTGATGAGCTCGGCGATGCCGTCGTACATCTCCTTGACGGCGTCGT
ACTCGGTGAGCCCCATGCGGCGCTTGTTGGAGATGTCGTACACGCCGCCCTCGGCCTCCG
TGTGCTCGCCGCGCGTGCCGCGGACCTGCAGGTGGTACTTGGACGCCACCTCCTCCAGCT
TCTTCTTGTCGGCCGCCAGCTTCGGCAGCTTGATGTGCACGGAGGCGCGGACCGTGGTGC
CCAGGTTGGTCGGGCAGAACGTGAGGAAGCCGAGCCGGTCGTGGTGCGAGAACGGGATCT
TCTTCTCGATCTCGTTGACGGCGCTCACCAGCCTCTTGTACACCTGCTGCAGGTCGCCGC
CCATCTGCATCGAGATGATGCGGAGGTGGTCCTCCTCGTTGCACCACACGAGGAACGTCT
TGTTCTCGTTGTGGTAGATGCCGCGGCCGGTGGGCCAGAAGCGGCAGGCGTTGGCGGCCT
GCATGAAGCGGTCGCCCTCCTTGAACAGGAAGTGGTCGTCGATGAGCTGCTGCTGGGTCT
CCTTCGACATGCCGGTGAGGGGGT
(744 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).