SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0024
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf12
6701349 bp
UniRef
UniRef50_Q9WR81 (98%/54)
Cluster: Polyprotein; n=31; root|Rep: Polyprotein - Bovine viral diarrhea virus 2 (BVDV-2)
Ontology
GO:0004252 F serine-type endopeptidase activity
GO:0006464 P protein modification process
GO:0006508 P proteolysis
GO:0016032 P viral reproduction
GO:0019082 P viral protein processing
Orthologue
Sequence
(Nucleotide)
TTTTTTTTTTTATATATTCTATTGTTATATTATTATTTTATAAATAAAAGTCAGCCTCTG
ACGACTTTTAACACAACTAACCAACAACTTAAGCGAGTTGTGTTTACACCCAAATGGGTG
AATTCAATAATGCGTTCATTTTTTCTGTTTAAGTTAGATGTTAATGTGGGTAGATTTTAT
CCTGTTGTGTGAACCTAATAAGTAAATAAATACATAAAAATTTAAAAAGTTGTGAGAGTA
GAGTAGGTGCCCGTGACAGAATTGAAACTTCCTTGACAGTGGGCAGACCAATTTCCATAT
TCATAAGAACAGAAGCTGCACAAGTTCGATGTACAATTGTTTTCTCATCAAAGAAGTTTC
CCTTCAATAAATAAAACCAACGTGTGAGCTCCGACACTGTGTCAAGATTTTATTTAAAAT
CCATCATACACAGCAGTCGCGAGCGTTCCTTACAGGCTAGAGGGGACTTATTTATTTGTC
GTCGTCTTTGAAGACCATCGTGCTATGACACTTCCCGCAGTAGTGACGGTCCTCCATCAC
CGCCATGAACACTCCGGCGCCGCACTGCTCGCCTGTGCACTCGCGCCGCAGACGGTGGAT
CTTACCGTTCTCGTCGACCTTGTAAAACCTGAGGACGGCTAGTTTGACCTTCTTCTTCTT
GTGCTTGATCTTCTTGGGTGTGGAGTAATTCTTCTTCTTGCGTTTCTTAGCGCCACCACG
AAGCCTCAACACCAGGTGGAGGGTGGATTCCTTCTGGATATTGTAGTCCGAGAGGGTACG
TCCATCTTCCAGCTGCTTTCCAGCAAAGATCAACCTTTGTTGATTGGGAGGGATTCCCTC
TTTGTCTTGAATTTTAGCTTTCACATTCTCGATGGTATCTGACGGCTCGACC
(892 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).