SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0022
JBrowseBomo_Scaf022
chromosome_No.
Scaffold_id
Scaffold Length
chromo2
Bm_scaf27
4962828 bp
UniRef
UniRef50_A7ARI8 (37%/43)
Cluster: Putative uncharacterized protein; n=1; Babesia bovis|Rep: Putative uncharacterized protein - Babesia bovis
Ontology
Orthologue
Sequence
(Nucleotide)
GTTTTTTTTTTTTTTTTTTTCTTTAAATATTTTAATAGGTTAAACATTCGAGTAGGTACG
TCTTAAAAGTACAATATATCTGACGAAATAAAAATTAAAAAAAAACAATTTGATCGCTAA
TAACTTCTCATTTTTTACAATTTAATTTTAAATAAAAAAAAAATCGTCACAATTACGAAG
ACATGATTTGATTATATATAAATACTTAAATTTCTAATTATTTTTTTAAAATACTCAATG
TACAGGGGTTACTCTAGTTTATTTATTTATTCGAATTACAGACTAAAAATATTTTTTTTT
TCTCTAATATTAATTTTTCTCATGACGATCTATCTATCATTACGTGTTAAATTGATTATG
CGATTGACTGGTGCGCGGACCGCACCCTAAGCCACGTCCACATCATGTCCAACAAGCATA
ACTATTGAATAATTTAGAATAATTTACATAATATTTTTTTTCTCCCTCCTAATTACAATA
ACAAAAACAAAACTACGCATGTCTCGCGCGATTTATAAAAGATTTAAATTATCAACTATG
GTCATTACTGTCGTTACTTCAAGCAGTGGTAGTTTTCCAATTACAGAGCATAATGCGACA
TAATGCGACTCAGTGACGCACAATGCCGAATTATGCTGAAGCTTAATTGGAACGTGAATT
AGTTTTCAAATGCACCAGCAGAGTGCGCTAAGTTAGCACAGTTTTAATTAACATTGATTA
TTTCTAAGAAACTACGACGAAACGAAAGCCTTACAATTTTTTTCAACATTAAATAATATT
ACTAACGATAATATAAACAAAATTTCGATCAATGCCAACTTAAAGAAAACACTTGGCAAT
TTTCTGTCCTGAGTCGGTATCGATTGCGAGTATCACGCGAGAGCAGTCCTCTTGAGAGTG
CTCGGT
(906 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).