SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0021
JBrowseBomo_Chr12
chromosome_No.
Scaffold_id
Scaffold Length
chromo18
Bm_scaf2
11281751 bp
UniRef
UniRef50_UPI0000D55CCD (41%/60)
Cluster: PREDICTED: similar to CG2931-PA; n=1; Tribolium castaneum|Rep: PREDICTED: similar to CG2931-PA - Tribolium castaneum
Ontology
GO:0000166 F nucleotide binding
GO:0004812 F aminoacyl-tRNA ligase activity
GO:0004832 F valine-tRNA ligase activity
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
Orthologue
Sequence
(Nucleotide)
TATTAGCGTTAACTTCTACAACGAAACCCGAACGTTATTCATGATGCGCGAATGTGTATG
TATTTTAACAAGCGACATATAGTGGTTCCAAAATTATCTAATATTAGTGCGTAAATCTTT
TGGAATTCTTTAAGGTTAAGGTTGGCGCTTCATCATGGAAGAATCCTCAAAGTTTCAACA
GATGCAAGATGAGATGTCCAGGTTTGAAGCTGAAATATCAGGAGGCACTGGACGTGCAGT
GATCGGATCTGGCACATGGGATGCCGTGCAAGCCCGTCTAGAACGGGTGGCTCCAATGCA
GGCCCCACCAGAACCCAGCCCTTCGATCATGGCACCATACGAGCCTACACTTGTGTACCC
TGCAGTACCTGCACCACCACCACCACCATCCTTATTGGTGCCAGCCCAAGTGCAAAGACT
TCCAAGTTCAACCGCAGCTATGGATGGGTTTGGTAGTCCAATACCGCTCCTTCGGCCTGG
ACTACCAGGCCCACAATTAATTCCTCCACCTCCACCCAAACCTCAACCTGTGGCTCTGTC
TGCTGCTCCTAAACTTTACAAGCAACCAAAAGAGGATGATGACAAAAAGGAGTAAGTCTG
CA
(602 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).