SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0019
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P24646 (75%/242)
Cluster: Polyhedrin; n=212; root|Rep: Polyhedrin - Spodoptera littoralis nuclear polyhedrosis virus (SlNPV)
Ontology
GO:0005198 F structural molecule activity
GO:0019028 C viral capsid
GO:0000166 F nucleotide binding
GO:0004672 F protein kinase activity
GO:0005524 F ATP binding
Orthologue
Sequence
(Nucleotide)
TTTGTAATAAAAAAACCTATAAATATGCCGAATTATTCATACACCCCCACCATCGGGCGT
ACTTACGTGTACGACAATAAATATTACAAAAACTTGGGCTGTCTTATCAAAAACGCCAAG
CGCAAGAAGCACCTAGTCGAACATGAACAAGAGGAGAAGCAATGGGATCTTCTAGACAAC
TACATGGTTGCCGAAGATCCCTTTTTAGGACCGGGCAAAAACCAAAAACTTACCCTTTTT
AAAGAAATTCGCAGTGTGAAACCCGATACCATGAAGTTAATCGTCAACTGGAGCGGCAAA
GAGTTTTTGCGTGAAACTTGGACCCGTTTTGTTGAGGACAGCTTCCCCATTGTAAACGAC
CAAGAGGTGATGGACGTGTACCTCGTCGCCAACCTCAAACCCACACGCCCCAACAGGTGC
TACAAGTTCCTCGCTCAACACGCTCTTAGGTGGGAAGAAGACTACGTGCCCCACGAAGTA
ATCAGAATTGTGGAGCCATCCTACGTGGGCATGAACAACGAATACAGAATTAGTCTGGCT
AAAAAGGGCGGCGGCTGCCCAATCATGAACATCCACAGCGAGTACACCAACTCGTTCGAG
TCGTTTGTGAACCGCGTCATATGGGAGAACTTCTACAAACCCATCGTTTACATCGGCACA
GACTCTGCCGAAGAAGAGGAAATCCTAATTGAGGTTTCTCTCGTTTTCAAAATAAAGGAG
TTTGCACCAGACGCGCCTCTGTTCACTGGTCCGGCGTATTAAAACACTATACATTGTTAT
TAGTACATTTATTAAGCGTTAGATTCTGTGCGTTGTTGATTTACAGACAATTGTTGT
(837 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).