SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0015
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf5
8683647 bp
UniRef
UniRef50_UPI000051A31E (89%/106)
Cluster: PREDICTED: similar to CG5830-PA; n=3; Coelomata|Rep: PREDICTED: similar to CG5830-PA - Apis mellifera
Ontology
GO:0003674 F molecular_function
GO:0005575 C cellular_component
GO:0005634 C nucleus
GO:0008150 P biological_process
GO:0016791 F phosphoric monoester hydrolase activity
Orthologue
Sequence
(Nucleotide)
GTTTTATGGTGTTAAAATTTTACAGAAACTCTGTCGCCGTTTGTATTAAGGCCAAAAACA
AATGTATAAATGGACGCATCGTCCATTATAACTCAGGTGTCACGGGATGACGAACAATTA
AACAATTATGGACCCGATAGAGGTTCATCCCCTGGTGTGCAGCATAATGAGGGTGACGGC
ACCCCAGTTTCGGGGTCGACCCCTTTGGGTGGGAAGAAATCTAGCGGGACCGGCGGCTTC
TTGCGATCGTTGCTGTGCTGTTGGCGCGGTGGCCGAGGCAAGGGACCTCCCGGAGGCAAT
GGCACCAATAGTATCGACGGCAGGGCTTCTCCGCCCTTGCTGGTCATGTCTGAACATGCC
CCCAGACCTCTGTTACCGCCAGTGAGACACCAGGACATGCATAAAAAGTGTCATGGTTAT
TGATTTGGATGAAACATTAGTGCACAGCTCATTCAAGCCTATAAACAATGCACATTTCGT
GGTGCCTGTAGAAATCGACGGTGCGGTCCATCAAGTTTACGTTCTGAAGAGGCCGCATGT
CGACGAGTTCCTGCGGCGGTGCGGCGAGCTTTACTAGTGCGTTTTGTTCACCGCGTCATT
GGCTAAGTACGCCGATCCTGTCGCCGATCTACTGGACCGATGGGGCGTCTTCCGCGCGCG
GCTGTTCCGCGACAGCTGCGTGTTCCACCGCGGTAACTACGTCAAGGACCTGAACAGCCT
C
(721 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).