SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0013
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf35
4373199 bp
UniRef
UniRef50_Q9A749 (37%/64)
Cluster: Ribonuclease, Rne/Rng family protein; n=3; Alphaproteobacteria|Rep: Ribonuclease, Rne/Rng family protein - Caulobacter crescentus (Caulobacter vibrioides)
Ontology
GO:0003723 F RNA binding
GO:0004540 F ribonuclease activity
GO:0005737 C cytoplasm
GO:0006396 P RNA processing
GO:0003824 F catalytic activity
Orthologue
Sequence
(Nucleotide)
AAAATATGGTTCTATTGTGATTTGTCGTTTTTATACGTGTTTTTCACCACAAACAGCACT
TTCTATCGATAGATACCATTCGTGCGCTTTATTCAGTATTGAAAAAAACCTAGAATCGGC
CGACGGAAGTGAATTTTTTTGATGTAAATACGGTCCGGCCAGGGTCAGTGTGGTGTGCTA
CCAATTTCGATCAAATTAGTTCGTAAACCCGTGCTTTTGTGTTCTGTTTGTGATTTTGGC
TTACGCGCTGAACGCACAAAACGCTAAACGTGTCCAAATTCGCATCAAAATTGTTGGGTT
AACCCCCAACATGGCCTGTTGAAGCATGGATGCGCGCTCGTGATCGCTTCACGGCGCGGA
GCGCGCGCCCGGACTTATATAAGAGACAGCGGCGGCGTTATGGCTGCGCGCGTGTCTGCT
GAGGGCGCAGGACCCTCTTACGCGTCCGTGCTCAACTTCAAAGGAGGCGAAAGTAATAAA
GAAAACATTGAGGCCCACGCAGAGGAGGCGTTAGACGCGCCTCCCAGGCCAGATATTGAA
GAGGAGGAGGGCTTCGTACCGGTCATCTCTCATGGACGGCGTCCTGGTAAAAACCGGAGG
GACAGGGAACGGAAAGCACCCCCGAGAGCTCATAAAACACCACAACAGCATGCTGACCCT
CAGCCCACAGCGGAGCAACAGCAACAAGCTGCAGAACAACAGCCGAAGAAGTTTGTTGAA
GCGCCTATTCCAAAAGTAATCCGTGGCAGGTCCGCGGAGGTAGCACGGGAGTGCCACCGC
CAGCGCCACCAGCCTTGGAACAAGAGAAGAGGTCGCCGTTGCA
(823 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).