SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0011
JBrowseBomo_Chr22
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf106
1120652 bp
UniRef
UniRef50_Q9H074 (28%/114)
Cluster: Polyadenylate-binding protein-interacting protein 1 (Poly(A)-binding protein-interacting protein 1); n=36; Euteleostomi|Rep: Polyadenylate-binding protein-interacting protein 1 (Poly(A)-binding protein-interacting protein 1) - Homo sapiens (Human)
Ontology
GO:0003723 F RNA binding
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0006413 P translational initiation
GO:0006417 P regulation of translation
Orthologue
Sequence
(Nucleotide)
AGAATTGTAATAAATAGTACCTACCTGCTACTAAATTACTATTGCATAGATTTCTTTGTT
TACGTGTCGATCCTTGCGAACGAAATACATGCCTACGAAAATAAATATATCTATCAAAGT
CGTTTATGGAATTGTATCAAAGCTGCATTGTAAAACTGCTGCCGTGGACTAATTGTTAAA
ATGAATAACGGTGATATTAGTGCTCCAAAAGGACGAGGCCGGGGGTGGCAAATGAACAAC
CAGGCACGCGAGCTCCGGCGGCCTAAGGCAGTTTCAGACGAACCAAAGGTGGATACTTCT
AAATCGAAGTTATCAGCAGATGCTAAAGAATGGTACCCTGCAAATTACACTTCTCAAGCC
CTACCCGCTTACAACACTGAACCTGCCCCATATAGACCATCTCGCCCCTCTGTACAAGGT
AGACTTCGTCAAGCTCAAGATCAAAATCCATACAATTTGGATGACATGTCTTATTCACTT
GAAGAAGCTGAAAACATGGATCTACGGGAGAACATAGCAAACTTGATAACTGTTATGTGT
GAGATAACCTTTGACCCGGGCAAGTTTGACACCTTGTGTGGTCCCTTGGTGGATTCATTT
GCTTCAACACTTAATGATGAAAGCTATACCAGACCCTTGGTGGATGCCATTGTTAATCAG
TCAATCGGCGAAGCAAATTTCCGGTACAATGGAGCTCGTTTGTGTTCAATGTACGATTCA
GTGGCGCAACCTGAGGAGTCTGTATTCCGCGAGTGCCTGCTCGAGCGCTGTTCCGTTGAG
GAAAACAAGATTATCAGCGGCTTGGAAACTTCAGAGGAGAATATGCGTGGATTTGCTATG
TTCCTTGCCGAGATTATACTCAGCTTTGAGGATAGTCAAGGAGGAAGAATAAGACTCTCG
GTGAAGTCTCTGCAAGTTTTCTGCATCTATTGGCACTGA
(939 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).