SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0003
JBrowseBomo_Chr27
chromosome_No.
Scaffold_id
Scaffold Length
chromo27
Bm_scaf123
705469 bp
UniRef
UniRef50_Q2L0Z7 (40%/49)
Cluster: Putative fimbrial usher precursor; n=1; Bordetella avium 197N|Rep: Putative fimbrial usher precursor - Bordetella avium (strain 197N)
Ontology
GO:0005215 F transporter activity
GO:0006810 P transport
GO:0009289 C fimbrium
GO:0016020 C membrane
GO:0016021 C integral to membrane
Orthologue
Sequence
(Nucleotide)
ATTTGTTAACAGCTACCCGAGCGCCTCCAAAGGAGACCTAACAACTCAAGAGTAGCTGCT
TCGCGAATGAATCTACTACCGGATCGGAATCGCGACCCGCTGAGAAGATCCGGCGAGAAA
CTCAGCGGGCTGATGTTTAGGTTAGGTTGTGCGTCGAACTCTTTGCCGAGTTCGACGAGT
ACGGTTACGAGCAAGATCATATACACCACCATATGATAGGATAGCCTTGCCAATAAAATA
AACATAACAAAAACCAATTAATTGCCTTCACAATACATAAACCACATTGTTTTCTTGTAT
AGGACAAGTTTATAGTCTTAGTATTTTATTTATGAATATAGGCTATCATTTATAATAGGC
GTTAACATTCAGTACGCTAAAATGAAATTGAAATGAAAATGAAATTTCACATTATTTATT
ATTTTTAAACTCCTATTAATTAGAATTTATTTCAAAAATTATTTTAAAATACCAAATGAA
AATTTCACTCTGCTATTTACAACGTACCTATGTATATGTTCTAAGGCTCCAATCTAAGCA
ATGAAACTGAAGAAATAATTGGATAATAATAATTGGAAAGTAGTATTATTATAATTGATT
TTTGATTGTCCCTAGTAGGAAAACGTTAAAGACAAACGCATTTTTATCATCTTATCAGTT
CGTATTCAGTATTCGTGATTACGTTATGTATATATATATATAAGTACATACATTATACAT
ACATATGTATGTATATGTAATGTATGTATATGCGTGTATATATGTACTTAGAAAAAAAAA
CTTACACGATCACATCCTGCCGACACGCTTACATCATTATACGCATTAGTCCAATCATGT
T
(841 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).