SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0001
JBrowseBomo_Chr21
chromosome_No.
Scaffold_id
Scaffold Length
chromo21
Bm_scaf7
8313734 bp
UniRef
UniRef50_P62841 (66%/75)
Cluster: 40S ribosomal protein S15; n=46; cellular organisms|Rep: 40S ribosomal protein S15 - Homo sapiens (Human)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005515 F protein binding
GO:0005622 C intracellular
GO:0005840 C ribosome
GO:0005843 C cytosolic small ribosomal subunit (sensu Eukaryota)
Orthologue
Sequence
(Nucleotide)
CTGAGGTTTGTTAAATATTTCCTGATTTTATCTTAATTAATTGAAGGAATCTCATATTTT
ATTGCAAATTTTGTCTGTATTATATCGTCAGCAATATGTGAAGAATCTTAAAACAGTGCT
ATTTAAGAAAAGTGAGCAACTATGTTTATGTTTTTCAGGTCGACGAAACCCTCAAGAAAA
AGCGTATTTTCAGGAAGTTCACTTACCGGGGAGTTGATCTCGATCAGCTCCTTGATATGC
CCAAGTTAGTATTTTTGAGTGTTCAATACCTTAAATGCAGTGTATCAAAAAAATTTGAGG
TTAAAGGATTCTTGTAACTGTTTACTGTCATGTTTCAAACTGAACTGTTGTACGTAAAAT
ATGCTTTAATGTACATCTATTACAGATTATTTTGGTATGGTGTAAGTCCATAGCATAGGT
ATAAGCCCATATCATTTATTTAATTTAACGTTTCAGTGAGCAACTCATGGAATTAATGCA
TGCCCGTGCGCGCCGGCGGTTCGCTCGTGGTCTTAAACGTAAACCAATGGCATTGGTCAA
GAAGCTGCGTCGCGCCAAGAAAGAGGCTCCTCCGAATGAGAAGCCAGAGATCGTGAAGAC
TCACTTGAGAAACATGATCATCGTTCCCGAGATGGTCGGTTCAATTGTCGGCATTTACAA
CGGAAAAACTTTTAACCAGGTACGCAAATCACAAATTCTATATTAAACGTATCAATTAGA
ACAAGAAATAATTAAACCCCCTAAAAGGCTAATCTTGCTATTTCTAAAAATTTAAATATT
AAAATTTATAGTTGTAAATCTACATAGGCAAGTAAATATATTTATTAGTACTGTGTGTGT
ACTAACATTTAAAAACTAACTGACAAGTTATTATTAGTAACCACTTAACATCAGGTGGGC
TGTGAGCTCGTCCACACATCTAAGCAATAAAAAAAAAAAAAAAA
(944 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).