SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0044
JBrowseBomo_Chr10
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf33
4426693 bp
UniRef
UniRef50_P40463 (41%/41)
Cluster: Protein VHS2; n=3; Saccharomyces cerevisiae|Rep: Protein VHS2 - Saccharomyces cerevisiae (Baker's yeast)
Ontology
GO:0000082 P G1/S transition of mitotic cell cycle
GO:0005737 C cytoplasm
GO:0007049 P cell cycle
GO:0000166 F nucleotide binding
GO:0004222 F metalloendopeptidase activity
Orthologue
Sequence
(Nucleotide)
CGTCTTCTTTCAAGTTGCGTGTCTACATTGTCGTTAAATGGTGGTGGGTTACAATAATCA
TTAAACACTAAGTGGACTGAGAATGAAGACATTCAACACTAGCTAGACAATTGTAGGCAG
TGACTTCGCTTCTAGCCTTGTATAGGATCTCAACATCCGGTATCCCCGTAGTTACATCAT
TTATTATACTACATATATATAATGAATACACATTTGTGATACACTATTGTTAAATTGTTT
TGCACCGTTATTTTCAATAATAAACACCCTGTATTTGAGATACAGCGTGGTATTTTTCTC
TCGTTCGTCCGTCACGGTGTGAAGCGGCCGAACGGGGTCGTCGAACCCGGTCTAACTGCG
ATTCGCGTGTTGATCGTGGCCGGCCGCACACGCGATCGAATTCACGACCAACAGTTACGG
CGTGGGTCTAGTATCAAAGTTAATCAAACCTAAAACAGTCGTTCAATTTTATATCTCCTG
CTTCAGCACTATCAAACATGCTACAATATCGAAAGTATGAGCTCTGCTTAGTGCGAGTTT
TTTAACTTTTACGCGATCGAGAACGTTACAAAAACTCGCAATAAGCACACCTGTTGGTAA
GTGGTTCCATAAA
(613 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).