SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0027
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf33
4426693 bp
UniRef
UniRef50_Q37953 (98%/50)
Cluster: LacZ protein; n=1; Phage M13mp18|Rep: LacZ protein - Phage M13mp18
Ontology
GO:0004553 F hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0005515 F protein binding
GO:0005618 C cell wall
GO:0005975 P carbohydrate metabolic process
GO:0003824 F catalytic activity
Orthologue
Sequence
(Nucleotide)
CAGTAATTGAATTGTTTTATTTCCCTGCAACCATCAAGACACGTTTGTAACAAAAATCTT
ATATGAAGACGCTTAATATGTGAGTTAGAACACGAACACAGAGACGAAATTGTTTAGTCA
ATAAAGATATCCTATATTTTAGATGTATATTTTTTTTGTATTTCTGTAATAAAAGATGTT
TATAAACGTCGACTCGAGGGGGGGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTA
CAATTCACTGGCCGCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCAAATTGTAAGCGTTAAT
ATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCC
GAAATCGGCAAAATCCCTTATAAATCAAAGAATAGACCCGAGATAGGGTTGAGTGTTGTT
CCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAA
AACCGCTATCA
(611 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).