SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0026
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf33
4426693 bp
UniRef
UniRef50_Q96483 (81%/112)
Cluster: Actin-51; n=584; Eukaryota|Rep: Actin-51 - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)
Ontology
GO:0000166 F nucleotide binding
GO:0005198 F structural molecule activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
Orthologue
Sequence
(Nucleotide)
AGCAGTCACTGCAGGGCGTTTAATTTTCATCTTGTCACACCTACATCTTACTAATTTCAC
TAATTCAAGATGTGCGACGAAGAAGTTGCCGCGTTGGTAGTAGACAATGGCTCCGGTATG
TGCAAGGCCGGTTTCGCAGGAGATGATGCTCCTCGCGCCGTGTTCCCCTCGATCGTGGGA
AGGCCCCGCCATCAGGGCGTGATGGTCGGTATGGGACAGAAGGACTCTTATGTAGGAGAT
GAGGCACAGAGCAAAGAGGTATCCTGACCCTCAAATACCCCATCGAACACGGAATCGTCA
CTAACTGGGATGACATGGAGAAGATTTGGCATCATACCTTCTACAATGAGCTGCGTGTCG
CCCCCGAGGAACACCCAGTCCTGCTCACTGAGGCTCCCCTCAACCCCAAGGCCAACAGAG
AGAAGATGACCCAGATCATGTTCGAAACATTCAACACGCCCGCCATGTACGTCGCCATCC
AAGCCGTGCTCTCGCTGTACGCGTCCGGCGTACCACCGGTATCGTGCTGGACTTCGGCGA
CGGTGTCTTCCACACCGTGCCCATTTACGAAAGGATACGCACTTCCCCCACGCCATTCCT
TGCGTTTTGGGACTTAACCCGGTCGGCGAA
(630 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).