SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0025
JBrowseBomo_Chr21
chromosome_No.
Scaffold_id
Scaffold Length
chromo21
Bm_scaf86
1549195 bp
UniRef
UniRef50_UPI0000E473E8 (31%/82)
Cluster: PREDICTED: similar to fibronectin 1a; n=1; Strongylocentrotus purpuratus|Rep: PREDICTED: similar to fibronectin 1a - Strongylocentrotus purpuratus
Ontology
GO:0008565 F protein transporter activity
GO:0015627 C type II protein secretion system complex
GO:0015628 P protein secretion by the type II secretion system
GO:0008415 F acyltransferase activity
GO:0016740 F transferase activity
Orthologue
Sequence
(Nucleotide)
CGTGTACGTAGTGTTCGTTAATAAAAACAAATACGAGAAATAAACAGATGATAATATTCT
ATATTTATTAATAATAATAATATTTGCCTATCAATTATGAGGAATAATTACTTGTTCGCG
TTTATTTTGATGTCGTTTACCGTGTGCACAACAATTGAACAATCTGGAAACCTTTTAACT
TTGAAGAAGCGGACGAGAAGAAAAATTGCAGAAGACGATTGGATCTGGAGTACTACCAAA
AGTCCGACTGCAGAAGAATAATGCCGAATTCAGAAGGTACAAATGCAACACAAGCTGTAT
TTCCGGTTCGTTCTACTCCAAGCGCGTCCACGATGGTCTCCAGCCAGCCTTTAATAATGG
CAGAGGGCACAGCGTCACCAAATGTTACGCTTACACCGCAAGACTTGATTTATAAGAAAT
GTCTTTCAGAATTGGAAACTTTGGTAATGCCAGATTACCGACAGAATAACCGACCGTACA
GTGACGTCCGATGCAGAGAAAATTATTGTTTTGCTGAGGCAACAAACACTTCAGCAATAT
CTGGTGAGAGAATGCGAATTCAAAGCTTTCAACATCCGCTACTACGTC
(588 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).