SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0021
JBrowseBomo_Chr14
chromosome_No.
Scaffold_id
Scaffold Length
chromo14
Bm_scaf38
4008358 bp
UniRef
UniRef50_UPI0000DB6D52 (87%/82)
Cluster: PREDICTED: similar to SET domain binding factor CG6939-PB, isoform B isoform 1; n=3; Endopterygota|Rep: PREDICTED: similar to SET domain binding factor CG6939-PB, isoform B isoform 1 - Apis mellifera
Ontology
GO:0004437 F inositol or phosphatidylinositol phosphatase activity
GO:0005737 C cytoplasm
GO:0016020 C membrane
GO:0046839 P phospholipid dephosphorylation
GO:0007242 P intracellular signaling cascade
Orthologue
Sequence
(Nucleotide)
GTCGACTCGCGCAGAAATTGTACGTTCGTCGACTTGTGCGTAAGTCAAAGAATGATCTGT
CATCACATTTCTTGGGCGGTCCGGGAGCCGGAGTGGCCTGCGTCACTGCTATCACTTCCG
CTAAATCAATGAATCCTTTACAGTGCGAGTCTTCCATCGCATCGTAGTATCGTAGCTGAT
GTTTTATCGAGTCCAACACGAACCATCTTTGTTTCCATCCCTTGAGTAGAGCGCCTCGCT
TGTAGAGATGCCCTCGTGCGTTCTGTTCTCGGCGACGTTCGACGAGAACTGTTCATAGTA
TTGTTGAGAGGAAGACTGTAGCCGTGCCGACACTGTCGTGCATGGCGGGGCGCAGGTCGC
GGTCGGGGGGCCGCGGGGCGCCTTGTAACTTTG
(393 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).