SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0012
JBrowseBomo_Chr1
chromosome_No.
Scaffold_id
Scaffold Length
chromo1
Bm_scaf23
5097954 bp
UniRef
UniRef50_UPI00015B4309 (76%/69)
Cluster: PREDICTED: similar to ATP-binding cassette sub-family F member 2; n=3; Apocrita|Rep: PREDICTED: similar to ATP-binding cassette sub-family F member 2 - Nasonia vitripennis
Ontology
GO:0000166 F nucleotide binding
GO:0005215 F transporter activity
GO:0005524 F ATP binding
GO:0005740 C mitochondrial envelope
GO:0006810 P transport
Orthologue
Sequence
(Nucleotide)
TATAGTTAGGCCTAAGGATGCCGTCGGACGCGAAGAAAAGGGCTCAGCAGAAGAAGAAGG
AGCAAGCTAGCGGCAGAAACAAGAAGCCGGTGGTTCGTGTGACGAACGAAGACGAAAATG
GTATCGGAACTAATGGTATATCCAGGGAAGACCGTGAGCTGACGGCAGAAGAGGCATTGT
GCCTTAAGCTAGAAGCTGAAGCGAAAATGAATTCTGAAGCTCGTTCTTGTACTGGGTCAC
TGGCTGTGCACCCTGTTCTAGAGATATCAAGATAGCTAACTTTTCAATTACTTTCTATGG
GAGTGAGCTACTTCAAGATACTCTCCTGGAGTTGAATTGTGGGCGAAGATATGGGCTAGT
CGGACTTAATGGGTGTGGAAAATCATCATTGCTTGCTGCCTTAAGACGCCGTGAGGTTCC
TATTCCGGAACACATTGACATATTCCATCTGACTCGAGGGGGGGCCCGGTACCCAATTCG
CCCTATAGTGAGTCGTATTACAATTCACGGCCGTCGTTTTACAAACGTTGTGACTGGGAA
AACCCTGGCGTTCCCCAACTTAATTGCCTTGCAGGACATTCCCCCTTT
(588 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).