SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0009
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf16
6248677 bp
UniRef
UniRef50_Q2FPL5 (48%/29)
Cluster: PKD precursor; n=1; Methanospirillum hungatei JF-1|Rep: PKD precursor - Methanospirillum hungatei (strain JF-1 / DSM 864)
Ontology
Orthologue
Sequence
(Nucleotide)
CGGATCCGCGGCCCGCCGAATTCGGCGGCGGCGGATCCGAGATGAGGGCCGATAGAAAAG
AATGGAATAAAAAAATTCGCTGTGCCGACCCCACCTAGTAGGATAAGGTGGAGACAAATT
GATAAATGGCATGGACAGCTATTTCGTAATATTTTTATTTTTTTTATTACTGATATGCTT
GGACGATCTCAGAGCCCACCTGCTGTTAAGTGGTTACTGGAGCCCATAGACATCTACAGC
GTAAATCCGCCACTACCTTGAGATATAAGTTCTAAGGTCCGAGTATAGACATTTGCGCTG
CTGCTTATTTATACCTGCTATGATCTACCCACAACGGGGTTTAAGATTATCGGTAGGAGT
TTAAGAGTAATCTCTTACTTTACGATTTCCGAATTTCGTTTAGCCATGCCGTGGGCTCGA
ATCATTGAACGAATCAAATTTGAAAATGTAAAATCGAGTATGCGTTTTATGGTTTTCGAA
CAAATGGAACTGGACGAAGAATAGAAAGGCATTTTCAACGCAACCCGGGCCACTCAAGGT
ATATTCTGGCTTTGGCTATACCGTAAAACATGGACCGGATTGTTATTAAAACTACCGTGG
CATAAC
(606 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).