SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0008
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf22
5301712 bp
UniRef
UniRef50_Q11WP9 (34%/81)
Cluster: Acyltransferase family protein; n=1; Cytophaga hutchinsonii ATCC 33406|Rep: Acyltransferase family protein - Cytophaga hutchinsonii (strain ATCC 33406 / NCIMB 9469)
Ontology
GO:0008415 F acyltransferase activity
GO:0016740 F transferase activity
GO:0016747 F transferase activity, transferring groups other than amino-acyl groups
GO:0003824 F catalytic activity
GO:0004806 F triacylglycerol lipase activity
Orthologue
Sequence
(Nucleotide)
TTTTTTTTTCATATTTGAATAATTACAAACTGAAGTAAATCACACTACAGAAAAAATATA
TATAAAACACGACACAAAATAAAATATGCATGTTTTTTTTATGAAATTGCAACAATAACT
ATGAAAGACTTTTAAAATAAAATACAAGTGGAACGGATTAAATGTCGGAAATCGACTCAA
GCGAAGTCTTGAGATGTCGATTTCCCACTATCAATCGACCGAAAATCGTTAGGCCCGACG
TTCCGGTACATAATAAAATATAACAAAATATAATATACACATTTTACGCTTTATATGAAC
TATAATAACAGTTACGGCTACATAAACTGTTACAATCCACATGATGAGCTGTAAATTATG
TTACAACGTCCTTAGTCCCAGACGCGGACGGTATTTGAACAAATGAAGCGAGCAAACATC
GCGATCCGGGACTCGAACGGTAAAGTTCACACCGGCACTTTCTATACTGGTCAACGTCCT
ATTTACCACTTTTTGGAAACACTAACACTCCTACATTTACATGATGCAGGCCATTTCAAT
AAAACTACGCTGGCTTAACATAAG
(564 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).