SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0007
JBrowseBomo_Chr16
chromosome_No.
Scaffold_id
Scaffold Length
chromo16
Bm_scaf4
9119588 bp
UniRef
UniRef50_UPI00006CFCE4 (48%/35)
Cluster: cation channel family protein; n=1; Tetrahymena thermophila SB210|Rep: cation channel family protein - Tetrahymena thermophila SB210
Ontology
GO:0008270 F zinc ion binding
Orthologue
Sequence
(Nucleotide)
TTCAAACCGAAACGCATTACTGCTTTACGGCAGTAATAGGCAGGGCGGTAATACCTACCC
GTACCTACGGGTGCACAAGATGCTCCAGTAAATTTTAGTAATTTCAAGTTTTCAAACTAA
ATTCGGGTTGTATTACATGTAAAGACATTCAAAATAAATATGTTTTGTTGAATTACGTAA
ACAATAAGGAAGCTACGTCTTTGTAACAGGAGAAAACTTCAAAGATTAGGGGCTCATATT
TCATGAATGAATAACATCTGTCAAACTGTCAAATAGGTGTTTCTGTAAAGTTCAGGGTAA
AACGACGGTTGATAAGGTAATGTTTTATGTAATACTGACGTTTTTAAGTATTGCTTGTGT
ACTTTGAGGGCAACTCTTAAGAAAAGTTTCTGGCTTAAAAACGTCATATGCGTTACCCGA
CATGTCTTCAGTATTTCTAAAGGGTTTTGATAAAAAGGCAACGAGTTCAAAAAAACAAAT
GGCCCACTATCTTATTCTGCTATTGAAAATTTTGGCCAGCTCTTTATTTAATACCAGCTT
TTTCATTTAGGGAAT
(555 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).