SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NameJFsbP01B06f
JBrowseBomo_Chr19
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
(no hit)
Ontology
Orthologue
Sequence
(Nucleotide)
GCCCACCCAAAATGAAATTCCTCGTTGCCTTCGCCCTGATCGCCGTGGCTTCGGCCCGTG
TCTTTGAACCAATTTCCGTTGGACCGGCACTCGTCGACACCTACGAACCCATCGACACCG
AACCCGCCTACGTGGACATCCCTATCCCTGACGGTGGTGCAGTGTCTGCTCCCGTGAAGC
CCACTCCTGTTGTCGTTGGACCTGCTGTTCCCTCCGGTGCCTCTCCTCTTGTGCAGCTCA
TCGTGAACGTCAACGTCCCCGCTGGTGTTTCTGATGGACCCGCTGAAATCAAGCCCGACC
CCGTTATTGTCGCCGAAGAGGCTGAAGAGGGCCCCATTGTCCCTGTCCCTGAGCCCGTCA
TCGTTGCTCCCATCAACCCCATCCCCGTTGCCCCCGTCATCATTGGCACTCCCATCATTC
CCGCTCCCGCCGTCACCCTCCCCGAGGAACTCAACTAAACGAATGTACAAAATGTATTCT
CGTTTCGATGAAATTAAAATAAACTAACAATTTTATAATTAAAAAAAAAAAAAAAAAAAA
C
(541 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).