SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20081
JBrowseBomo_Chr6
chromosome_No.
Scaffold_id
Scaffold Length
chromo6
Bm_scaf111
965032 bp
UniRef
UniRef50_Q08473 (86%/82)
Cluster: RNA-binding protein squid; n=22; Endopterygota|Rep: RNA-binding protein squid - Drosophila melanogaster (Fruit fly)
Ontology
GO:0000166 F nucleotide binding
GO:0000184 P nuclear-transcribed mRNA catabolic process, nonsense-mediated decay
GO:0000381 P regulation of alternative mRNA splicing, via spliceosome
GO:0000785 C chromatin
GO:0003676 F nucleic acid binding
Orthologue
Sequence
(Nucleotide)
CGGCACGAGAAACTTTTTGTTGGTGGGCTGAGCTGGGAGACCACAGATAAGGAGCTCCGT
GATCATTTTGGAGCATACGGTGAAATAGAGAGTATTAATGTAAAGACAGATCCAAACACA
GGCAGATCACGAGGGTTTGCCTTCATTGTGTTTAAGGCCCCAGAGTCAATAGACAAGGTC
ATGGCTGCTGGTGAACACACCATCAACAACAAGAAAGTAGACCCAAAGAAGGCTAAAGCA
CGACATGGGAAGATTTTGTCGGAGGACTCAGCAGTGAAATCTCAGATGATGAAATCAGAA
ACTTCTTCAGTGAATTTGGAACTATCTTAGAAGTGGAGATGCCCTTTGACAAAACAAAGA
ACCAAAGAAAGGGCTTCTGTTTCATCACATTTGAATCTGAGCAAGTTGTAAATGATTTGC
TTAAGACTCCCAAAAGAACAATTGGTGGAAAGGAGGTCGATGTGAAGCGTGCAACACCAA
AACCAGATGGCCCCGGAGCATAGGCACGGAGGTGGCCGCGGCGGACGCGGTGCCAGAGGA
GGCCGCGGCGGCCGTGGTGGATACGGCGGCCAACCTTGGGGTAACCAGGGTTACGGCGGC
TACGGCTACGGTCAGGGTGGCTATGGCGGCGGATA
(635 bp)

- SilkBase 1999-2022 -