SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30019
JBrowseBomo_Chr22
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf18
5904300 bp
UniRef
UniRef50_Q9BPR7 (45%/168)
Cluster: Cuticle protein; n=4; Bombyx mori|Rep: Cuticle protein - Bombyx mori (Silk moth)
Ontology
GO:0042302 F structural constituent of cuticle
Orthologue
Sequence
(Nucleotide)
CAAACGTACAACATGTTCTCCAAAATCGTAGTACTGTGTGCTTTGGTCGCGGTGTCGAAA
GCTGGACTTCTGGCTGCTCCCGTGCACTACTCTCCCGCTGAAGCCGTTTCTTCCCAAAGC
ATTGTGCGCCATGACCAGCCTCAGCTCCACGCTGCCAAGCTCGCTGTTGCTACCCCTGTA
GCCTACCACGCGGCCCCTGTAGCGTACCAGGCCGCCCCAGTTGCCTACCACGCGGCCCCT
GTAGCGTACCAGGCGCCCCAGTTGCCTACCACACTTCTCCACTCCGCTACTCCTCGGCTG
AATCTGTCTCGTCCCAAAACATCGTCCGTCATGACCAGCCCCAGACTATCCAATACGCCG
CTCCTGTAGCCAAGTTGGCCGTCGCTGCTCCCGTAGCTTACCACGCTGCTCCCGCCCCTG
TTACCTACCACGCCGCCCCTGCCGCCGTGTCCTACCACTCTGCCCCAGTAGCCAAAATCG
TAGCTCACCAAGCTGAGGAGATTGCCTACCCAAGTACGAGTACAACTACTCAGTAGCTGA
TGGTCACTCCGGGCGATAACAAGTCCCAACAAGAGGTACGCGANCGGTGATGTAGTAAAG
GGTTCATACTCTTTCCACGAAGCTGACGGGCTCTATCAGAACTGTTGAAGTACACCGGCT
GAACGAACCACAGCGGGCTTCAAACGCGGTTCGTTCCACAACACCGGCCCCCCAACAGC
(719 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).