SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0005
JBrowseBomo_Chr18
chromosome_No.
Scaffold_id
Scaffold Length
chromo18
Bm_scaf2
11281751 bp
UniRef
UniRef50_Q17IM8 (95%/49)
Cluster: Butyrate response factor 1; n=2; Culicidae|Rep: Butyrate response factor 1 - Aedes aegypti (Yellowfever mosquito)
Ontology
GO:0003676 F nucleic acid binding
GO:0008270 F zinc ion binding
Orthologue
Sequence
(Nucleotide)
CATAGGCGGTGCAATTGGACCAATCGGTGCTAACTCAGTCTCAAGTGGTCTAAGCTGGGA
GCAGCATCCAGTGCTGTCGCGCGCTTCCTCTGTACCAGCGCATCGTGCCTTAGCCGGTCT
CTTAGACCGTCTGGGTCATCGCCGTCTCGAACGCACCACCAGTGAACCGGCTCCTCCGCC
ACCAGCCACAAGTCGCTACAAGACCGAGCTCTGCCGACCGTTTGAAGAAGCGGGGGTTTG
TAAATATGGGGATAATGCCAATTTGCTCACGGCGTCCGCGAACTACGCAATCTTCAGCGT
CATCCTAAATACAAGACGGAGCTGTGTCGCACTTTCCATTCGGTTGGCTTCTGTCCTTAT
GGACCGCGTTGCCATTTCGTGCATAACGCAGAGGAAGCAAGACGCAGAGAACCATCGTCG
CCAGGAGGTTCATTGGCATCGCTCTCATCGGGCGGATCTATGGCGTCGTATATGAGCGAC
GGGTCGCGATCGCCACGCTCGCCGCATTTCCATTGACGCCTCACTCTCCACCTGCGATGT
CGCCACCAGCACAGGCCACAGCTTTCGCTTTTCGCCGCACGAACTCCCCCGATCCGGAAG
ACGACCGACTGCCCGTTTTTAACCGACTTTTCATCGGCTCTCGGCGATCTCGTTCATCGC
TTAGTGCGATGGACTAGTCCTAAGTTAATTTATAACCG
(698 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).