SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0035
JBrowseBomo_Scaf002
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf11888_contig57098
734 bp
UniRef
UniRef50_Q5KTM6 (45%/184)
Cluster: Reverse transcriptase; n=1; Bombyx mori|Rep: Reverse transcriptase - Bombyx mori (Silk moth)
Ontology
GO:0003964 F RNA-directed DNA polymerase activity
GO:0003723 F RNA binding
GO:0006278 P RNA-dependent DNA replication
Orthologue
Sequence
(Nucleotide)
GGATCCGCCGCCGCCGGTTTCCAAGAATCAGGAAAGTTGCTAGAGGTAAAGGAAAAATTG
AAAATATCGGTAAGTATAGGTGCTACCGTTGGAAGAATTAGGGCAATCATTTTAGAGCAT
ACGTTATCAATTCCAACAGCCGTGGATGAGATGGAGAAAAAGGAATTACGGACATCAGCA
ACCGAGACTGGACTTAATTCAAAAATAGGGATCCGGGGTACGGATAGACTTGAAATCTTA
AGCAACGTGGCCGTCTTTGACGAATCACTGAGTGACACAGGAGGGAGAGAAAAATGCTTA
TTGAGGGCGCACAAGTCAGTATCCTTGACAGAAGAGACCGGAGTTTTGCCAATGCCGACA
GATTTAAGGAATCTCCAAGTATGAGCAGGGCTGCGATTTTCAAGTGATTTGTGAAAGTAA
AGTCTTTTAGCATCTCTGCACAAACGGTTGCACCGGTTGCGCAGTGCTTTGTATATGGCC
AGGCTGTGTTCAGTGGGGCAACGTTTGTATCTTCTTTTGGCTTTGTCCCTGCGAGCCATC
AGAGTTTTAATATCCGGCGTTAACCACGGTGCAGGTTTATGTTTAATTCGAACTCGACGG
ACGGGGGCATGCTGATCAAACAAACTGATTACCTTATAATTAAAAGAATTGACCATGTCG
TTAATATTATGGTGTTCAAGAATACACGACCAGTCGGTATTATTTACATCCCGTCGCAAC
GCTCCCAGATCAATACCCTTGTAATTGCGAAGTA
(754 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).