SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namecesb0018
JBrowseBomo_Chr1
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf21
5628829 bp
UniRef
UniRef50_A0MNZ0 (95%/22)
Cluster: NADPH oxidoreductase; n=1; Bombyx mori|Rep: NADPH oxidoreductase - Bombyx mori (Silk moth)
Ontology
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0003743 F translation initiation factor activity
GO:0005669 C transcription factor TFIID complex
GO:0006352 P transcription initiation
Orthologue
Sequence
(Nucleotide)
CTCAAGGTGGGTGGCGCATTTACGTTGTAGATGTCTATGGGCTCCAGTAACCGCTTAACA
CCAGGTGGGCTGTGAGCTCGTCCACCAGTCTAAGCAATAAAAAAAAGGTAAACATTGCGC
TAGATTAAACCATTGTTTCGTCTGTTTTTATATAAAACAGGAATCATACGCTTCCTAGTG
CGCGTTGAAATTAAGCGAAATCGTACAGATCTTGAAAGAGTAGATAGATTGTCTATTGTG
CAATTATACGTGCTTGTTGACTGGTTTTCAATGTTGATTGTGTTTTGGTGTGCATTAAAG
TATAGTCTCTCTCTTTCTCTTTCTCTTTTTCTCTCTCTCACTATACAATTTAACTTTTTT
AAGAGCCATCACATCATGAATGCCGCCACCCGCCTTTAGACACTTGATCGATTTCTTAAT
TGTATAGCAACATTGACTGTTCAAAAAGTTTCACTAAAATTATAAACATATCGTATGTTC
TGTTCAGGTGACCTCGGGCCCTCCTCCAGCAACCTCATACCTCTGGGCCAAATCAAACAA
GAGCCGGATCTCCACACGCCATCCCGAAGACGTGCCAAACTAAAGCCTGACTTGAAACTA
AAGGTATCAGTATGCAAGGTATTATCGGCTTGTTCATATTTTCATACGCAAATAACACGA
CACGTTAGGAGTACAAGTAAAGTGTAATGACCGTCCTAAGCATGAGCATGACTTACTAAT
GTGCGAATGTATTCTGTATGCACCCAATTCTCTACGGCGCGAACTGGAAGCAATCACGCG
GTCCGACTTGAGGGTCGTCGTTGTTCTAAAGCATATATTATGGGCAAAAACCCACTGTAC
GATATGATCCGGCCCGAGACATTTGAAAAAACCCAAATAAAAAAATATACATTAGGCACT
TATACTCCCGGCACCCGGCGGGCCCATCT
(929 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).