SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
Namece--0031
JBrowseBomo_Chr13
chromosome_No.
Scaffold_id
Scaffold Length
chromo13
Bm_scaf1
16203812 bp
UniRef
UniRef50_Q2HZG0 (100%/74)
Cluster: Yellow; n=2; Bombyx mori|Rep: Yellow - Bombyx mori (Silk moth)
Ontology
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0006583 P melanin biosynthetic process from tyrosine
GO:0007275 P multicellular organismal development
GO:0007617 P mating behavior
Orthologue
Sequence
(Nucleotide)
CGCGAACATAGGCTAGTTTTGAGTAAATAAAATGGCAGCGAAGTTTTTAGTTTTCTGTGG
GCTAGTCTCACTAGCATCAGCAACGATAAAGCTCCAAGAAATATTCTCGTGGAACGTGGT
CGACTGGAACTACCCGGACCAGTTCTCGAAGCAGCAGGCTCTCAGGACTGGTGCTCTGAT
ACCAGAGAACGCACTGCCCGTTGGTATCGAAAGGTGGAGGAACAAATTGTTCGTCAGCGT
TCCTAGGTGGCGCTAGGTATCCCAGCTACTTTGAACTACATTCCACTGGACGCTCCATAT
GAACCATCCCCGAAATTAACGCCCTACCCGAGCTTCGAAGGCAACGAATTAGGCAATTGT
CAAACAGGACTGACTACTGTATACAGGGTCAAAGCAGACCAGGTGTGATCGGTCTTTGGG
TATTAGACGTTTGGCACTTATGGATACGACAACGTTACAAATGTGTGCCCCGTACACGCT
CAATGTATTTTGACTTGAACACTGATCAAATCATCCCGTAAATACGTTGTTACGACCCAG
AAGACATTGTCTTCTACG
(558 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).